High Altitude Adaptations and Recommendations!

                  High Altitude affects the human condition in a number of ways. Ever heard of a Timberline? If you are from Colorado like me you have. It is an actual line on a mountain, albeit an invisible one, that after you cross that line there are no more trees. It is really cool! There is not enough oxygen past that elevation to support tree growth. People too have a hard time breathing the thin oxygen.

                  When you visit Denver from California there are a number of short-term adaptations you will notice. You may become light headed or nauseous until the adaptations occur. Your breathing and heart rate will accelerate up to twice as fast to accommodate the low levels of oxygen.

                   Over time, aka a facultative adaptation, your cheeks will turn a rosy red color due to the excess red blood cells your body is producing to carry more oxygen. Don’t worry; it happens to everyone so you won’t look weird!

                  A developmental change would be noticeable in one’s offspring. Lung size increases to accommodate the conditions. Where your body had to make minute changes to get used to the condition, your baby would be born used to it. Cool huh?

                  A cultural adaptation is easy to spot. Sun block is seen more in CO than on the beaches of CA. You don’t see sun tan oil glistening on the shoulders of sun worshipers… they would be fried in 5 minutes! Being a mile closer to the sun doesn’t seem like much when the sun is as far away as it is, but being a red head, I wont tan in the CO sun. Long sleeve shirts will be seen even in the dead of summer because of the harsh rays. Hats, shoes and pants are not only wintertime dons in this climate!

                  This is not just an assignment but also a pre-summer guide to traveling. This information is highly useful to anyone planning a trip to the Rockies this summer. And a word from experience… Even if you’re like me and only get asthma symptoms every once in a blue moon… take an inhaler! Shorts are fantastic but I suggest alternating between jeans and shorts as to not fry your legs, and as cute as camis are in the summertime… cover up those shoulders!

                  The United States is a melting pot of races. There is no one race in High Altitude states. You cannot look at a Coloradoan and a Californian and differentiate between them based on physical looks alone. Asians and Blacks look different, this is a fact, but you cannot stereotype them based on looks alone. When you live in different climates, you become adapted to each one. Race has nothing to do with it unless you are indigenous to that area.

Pulse and breathing Doubled

Red Cheeks From Increased Blood Production.

Increased lung size in following generations or generations native to high altitude.

Long sleeves, long shorts and shoes not uncommon in summer months.

Language Experiment- Or rather a lack of language experiment.

I found this experiment to be fun albeit, slightly difficult! It was like playing a game of charades! When my partner realized I couldn’t use any kind of language, they started picking up on similarities in my movements to things. They would then “oh! Is that a rabbit? Ok the rabbit jumped overrr…. What?” Things of that nature. Charades is the best thing I can think of to describe it!

I think the speaking culture would obviously have the upper hand. They would probably find the gesturing culture to be primitive and may wonder why they don’t just talk. In our culture, obviously a speaking one, people who cannot speak are usually looked down upon. Autistic people and other handicaps that prevent them from living their lives as normal humans do are spoken to like children. They constantly require aid and do not understand thing as quickly as we might. This may be a necessity but it does seem demeaning.

In the second part of the experiment, would could not use language embellishments. I felt like a robot! “Hi. My. Name. Is. Kendell.” Blah blah blah, IT WOULD SUCK TO TALK LIKE THAT AL THE TIME! It was extremely difficult. Actually, I found it to be hard than the first conversation. I had to sit on my hands to not use them. Laughing fits littered the experiment because we sounded so odd! Honestly I don’t think we even lasted a who;e 15 minutes! We don’t realize how much we use octaves in our voice and our hands to emphasize points until our ability to utilize them are stripped. I don’t know about everyone else’s heads but even when I type I hear the words I am typing playing out and that, subconscious voice, uses embellishments too.

If you can read body language it helps you but it is not necessary. Honestly, we use our hands a lot and fidget with things our transfer weight on our feet but these things don’t really help people to understand what we are saying. All is does is help us to get out the words we are trying to say smoothly in a flowing manner. When hand motions were banned I found that my speech was quite choppy. I had to fish for the words I wanted instead of just speaking flowingly.

An environment where it may be a good thing to not read body language… It is hard to pick one because only the practiced actually read what people say with their bodies. The first thing that popped into my head is a Junior High School hallway during a passing period. It has been a looooong time since I was in Jr. High but I remember kids all over each other and every kid dressed alike. There was no individuality, no variation amongst them. It is a time when kids don’t really know who they are yet so they experiment or copy others to fit in. Also, kids are just starting to notice that boys are kinda cute or vice versa. The body language here is probably best left unread!

Piltdown Fraud

            The Piltdown bones were found in a small village called Piltdown in England. It was all started in 1912 when Charles Dawson found a piece of an ancient human skull, or so he said. Nevertheless, he recruited help and ended finding more bones and piecing them together to make what was a fantastic archeological discovery at the time.

            Bias, greed and forgery came into play. Many years later, scientific aging equipment led modern scientists to an amazing discovery! The bones were not millions of years old but a hundred! The true suspect is unknown, but scientists speculate that Dawson may be the culprit. The jawbone, recovered at the grave mound site in Piltdown, was tampered with; as was the canine tooth. Both were filed down to resemble a more human appearance. In fact, after the discovery of the age of the bones, scientists found that the fossils were not only filed down but also superficially stained to appear older. These discoveries as a whole negatively impacted the scientific process by exemplifying that science can be fooled.

            The saving grace, in my opinion, is the fact that the frauds were found. This can reinstall the faith people have in science by ensuring that frauds can be found and proved wrong. Scientists working on the case used orangutan jaws, which is what the original fraud was, and replicated the fraudulent fossils. Putting stain and files to use, an exact chemical and visual replica was achieved.

            I don’t think it is possible because neither apes nor dogs can perform science. Therefore without the human factor there would be no science. I wouldn’t want to remove it anyways because disagreement is what fuels discoveries.

            This is where the scientific method is a perfect fall back method. Don’t just believe what anyone else says to be true. Find out yourself. Obviously we are not all scientists but those who are, need to scrutinize every aspect of a claim and prove or disprove it. For years, the people of England idolized Dawson and his discovery. How do you think they felt when they found out he was a fraud?

Primate Diets Compared

Diet

Lemurs (Prosimians/Strepsirhini): Most all lemurs are found in Madagascar and it’s neighboring islands. However, the habitats of these cute fuzzy guys, varies immensely from wet tropical lands to erred desert landscapes. Lemurs stick to a vegetarian diet. They prefer to eat leaves, berries and fruits. They do, however, like to eat bug occasionally and if necessary, smaller animals. I can see where this odd diet would come from the scarcity of fruits and leaves in the desert, making insects or small animals the diet of choice, but in the jungle vegetation is in abundance. http://www.thewildones.org/Animals/lemur.html This is the site my information came from.

Spider Monkey (New World Monkey/Platyrrhini): The spider monkey’s habitat can greatly vary depending on threats or complications in the desired areas. However, they almost never go down to the ground, preferring to spend the bulk of their time in the tops of trees. The ideal habitat is an evergreen or mangrove forest. Spider monkeys are mainly vegetarian. They like to eat a variety of fruits and berries. Occasionally they will eat leaves and bark, or even insects and bird eggs. Living in the tree tops, vegetation can be great but if wind knocks fruits down or the forest isn’t reproducing this may be the cause of the varied diet. Obviously, there are not many other small animals for them to eat all the way up there! http://www.honoluluzoo.org/spider_monkey.htm My Spider Monkey source!

Baboon (Old World Monkey/Cercopithecidae): After checking a variety of sites, I found that all say Baboons have a variety of habitats. The main requirements of a baboon habitat is readily available water and a safe sleeping arrangement. They like to sleep in the tops of tall trees or on the faces of cliffs! The odd part about their preferred environments is that they can go days without drinking water, yet they like to be near it anyway. Their diets consist of many things. The largest quantity being or grass, but they enjoys leaves, fruits, and other vegetarian edibles. The neat thing about baboons that makes them even more adaptable is that they are omnivores. They will eat a variety of meats if they need or want to. I believe this is due to their various habitats. If a vegetarian diet is not of abundance where they live, but smaller animals are, then there you have it. My baboony factoids came from here! http://www.outtoafrica.nl/animals/engbaboon.html

Gibbon (Lesser ape/Hylobatidae): Gibbons are an endangered species that live primarily in Southeast Asia. The spend most of their lives in the tops of trees and are not highly preyed upon because they are quite alone all the way up there and because they are very agile. Therefore, being preyed upon is not the reason they are endangered, deforestation is. It is taking away their habitats and changing they way they live their lives. Gibbons, like baboons, are omnivores. They eat mostly plants and vegetarian fare, but they will also eat small birds, eggs and bugs. Much like the other primates discussed, these animals have had to adapt to their way of living. Trees boast much vegetation but not tons of other animals. So small birds and their eggs sometimes fill that void. Gibbon facts: http://www.enchantedlearning.com/subjects/apes/gibbon/

Chimpanzee (Great ape/Hominidae): Chimpanzees can live in a variety of different habitats. This allows them to spread over a larger area than most primates and occupy about 21 African countries! They, like others monkeys we have described, prefer tree habitats that are high, moist and closed canopied. Chimps are mainly vegetarian, eating only seasonal fruits, leaves and bark. One of the biggest, and most important, parts of their diet, though, are termites. Females need them more than males do and other meat is eaten as well. Larger animals such as pigs and antelope can also be eaten but meats only make up about 5% of their diet. This can make sense when they are traveling from one forest patch to another. This is one of the only times they come down to the ground. http://www.honoluluzoo.org/chimpanzee.htm Chimpy facts came from that site… ß

All of these primates prefer trees and vegetarian eating habits. Only some are omnivores but they all eat insects. I am guessing that this is because of a need for protein. Monkeys are quite agile in terms of habitats. They are resourceful though, and live where they can find sufficient nutrition and safety. 

Analogy and Homology!!!

Analogs:

1. Flamingo   2. Great Blue Heron

1. a) Flamingos are peculiar birds that live in tropical climates. They prefer to live in wetlands because they eat fish. They typically do not migrate but due to environmental changes, some migration is becoming apparent.

http://www.seaworld.org/infobooks/flamingos/fhabitat.html

1. b) The great Blue Heron is much like the Flamingo, but these birds live all over. They too prefer wetlands. There are abundances of them in throughout the United States. They like to migrate north in the summer to breed and south to Mexico in the winters. However, they keep year round residency throughout the bulk of the United States.

http://www.allaboutbirds.org/guide/great_blue_heron/id

2. a) The analogous trait in these two birds to me is their necks and legs. Both have odd backward knees, which are actually their ankles. Both have long necks to be able to reach the water without interference of their long legs. Both of these birds live in marsh areas and eat primarily fish. This is why I believe their legs are an analog trait. They must both wade in the water for their food.

3. I do not believe that the ancestor of these odd birds had the trait. When you look at most birds, may it be water, game, finch or predator, all have an array of feet, but their legs are short.

Homologs:

1. Elk   2. Horse

1. a) An Elk is a large deer that lives in mountainous regions. They are vegetarians and herd animals. They have antlers and they shed them at the beginning of each spring.

1. b) Horses are herd animals as well. They do not require specific living conditions; they can endure both frigid winters and summers. They are vegetarians and they, like most animals (including elk), typically reproduce in the spring.

2. The homologous trait in question here is their hooves. These animals are very similar in build and attitude in a wild herd. Elk, however, have split hooves. Horses have one solid hoof. Evolution has obviously come into play here because a common ancestor of the two is a dinosaur-esque mammal that had three toes. This odd animal actually derived from a dog-sized animal called the Hyracotherium. http://chem.tufts.edu/science/evolution/HorseEvolution.htm This is a really neat site that shows the evolution of this animal, up to a horse equus, through skeletons.

Here is a picture of what scientists perceive the equine ancestor looks like. Oddly like a deer-ish horse?...

My DNA!

TGACTACTTGTAAGAGCTGAATCACGGCAGTGCTAGGCTCTAGTGGATCCGAT


Here is my DNA :)
De-code away!
Kendell

Malthus' Contribution to Darwin's Discoveries

I would have to say that, personally, I believe that Thomas Malthus was the biggest influence on Charles Darwin for the soul reason that his work was sort of a precursor to his ideas. He was introduced to the works of all 5 of these men at a young age but Malthus’ essay An Essay on the Principle of Population “inspired both Charles Darwin and Alfred Russel Wallace in their separate discoveries of natural selection.” (Intro. to Physical Anthropology 30).

                Malthus’ essay described the effect of the rise of human populations and food resource production. He argued that if human beings did not monitor their reproduction, the resources handy for consumption would be a “constant source of misery and famine” (31)

                In this site you will find a brief explanation of Malthus’ discovery and its affect on Darwin.

 http://www.victorianweb.org/science/darwin/intro.html (halfway through second Paragraph).

                Quite fitting, though it may seem, is the fact that the very first bullet point is a pinnacle point of Malthus’ ideas! The bullet ends with a question, “But we are not up to our eyeballs in rabbits are we, why not?”. I like this question because it makes you think and also makes you consider Malthus. If his conclusions are correct, then resources are a pivotal reason as to why reproduction is lowered. Think about it, now a day’s food costs a lot of money. So, if you have trouble feeding yourself and your partner, are you going to have a baby which needs diapers and formula? No. I know it is not exactly the point but it runs the same lines. If a rabbit produces babies 200 times in their lifetime, they will always be providing for young. Does this account for dry and cold winters or droughts? Probably not.

                I think Darwin would have arrived at his conclusion without Malthus but in some other way. Malthus inspired Darwin, this is true, but without him someone else probably would have inspired him instead.

                Though Darwin attended Christ’s College at Cambridge, he was not an extremely religious person. However, the church was not thrilled with Darwin’s discoveries of evolution because it strictly contradicted their belief of creation.

Very First Post!!!

I scoured the glossary for a cool title and came up with Terrestrial Taxonomy but thats not all we will cover in this course so I tacked on "and more".  
I really look forward to this class!
Kendell