Analogy and Homology!!!

Analogs:

1. Flamingo   2. Great Blue Heron

1. a) Flamingos are peculiar birds that live in tropical climates. They prefer to live in wetlands because they eat fish. They typically do not migrate but due to environmental changes, some migration is becoming apparent.

http://www.seaworld.org/infobooks/flamingos/fhabitat.html

1. b) The great Blue Heron is much like the Flamingo, but these birds live all over. They too prefer wetlands. There are abundances of them in throughout the United States. They like to migrate north in the summer to breed and south to Mexico in the winters. However, they keep year round residency throughout the bulk of the United States.

http://www.allaboutbirds.org/guide/great_blue_heron/id

2. a) The analogous trait in these two birds to me is their necks and legs. Both have odd backward knees, which are actually their ankles. Both have long necks to be able to reach the water without interference of their long legs. Both of these birds live in marsh areas and eat primarily fish. This is why I believe their legs are an analog trait. They must both wade in the water for their food.

3. I do not believe that the ancestor of these odd birds had the trait. When you look at most birds, may it be water, game, finch or predator, all have an array of feet, but their legs are short.

Homologs:

1. Elk   2. Horse

1. a) An Elk is a large deer that lives in mountainous regions. They are vegetarians and herd animals. They have antlers and they shed them at the beginning of each spring.

1. b) Horses are herd animals as well. They do not require specific living conditions; they can endure both frigid winters and summers. They are vegetarians and they, like most animals (including elk), typically reproduce in the spring.

2. The homologous trait in question here is their hooves. These animals are very similar in build and attitude in a wild herd. Elk, however, have split hooves. Horses have one solid hoof. Evolution has obviously come into play here because a common ancestor of the two is a dinosaur-esque mammal that had three toes. This odd animal actually derived from a dog-sized animal called the Hyracotherium. http://chem.tufts.edu/science/evolution/HorseEvolution.htm This is a really neat site that shows the evolution of this animal, up to a horse equus, through skeletons.

Here is a picture of what scientists perceive the equine ancestor looks like. Oddly like a deer-ish horse?...

My DNA!

TGACTACTTGTAAGAGCTGAATCACGGCAGTGCTAGGCTCTAGTGGATCCGAT


Here is my DNA :)
De-code away!
Kendell

Malthus' Contribution to Darwin's Discoveries

I would have to say that, personally, I believe that Thomas Malthus was the biggest influence on Charles Darwin for the soul reason that his work was sort of a precursor to his ideas. He was introduced to the works of all 5 of these men at a young age but Malthus’ essay An Essay on the Principle of Population “inspired both Charles Darwin and Alfred Russel Wallace in their separate discoveries of natural selection.” (Intro. to Physical Anthropology 30).

                Malthus’ essay described the effect of the rise of human populations and food resource production. He argued that if human beings did not monitor their reproduction, the resources handy for consumption would be a “constant source of misery and famine” (31)

                In this site you will find a brief explanation of Malthus’ discovery and its affect on Darwin.

 http://www.victorianweb.org/science/darwin/intro.html (halfway through second Paragraph).

                Quite fitting, though it may seem, is the fact that the very first bullet point is a pinnacle point of Malthus’ ideas! The bullet ends with a question, “But we are not up to our eyeballs in rabbits are we, why not?”. I like this question because it makes you think and also makes you consider Malthus. If his conclusions are correct, then resources are a pivotal reason as to why reproduction is lowered. Think about it, now a day’s food costs a lot of money. So, if you have trouble feeding yourself and your partner, are you going to have a baby which needs diapers and formula? No. I know it is not exactly the point but it runs the same lines. If a rabbit produces babies 200 times in their lifetime, they will always be providing for young. Does this account for dry and cold winters or droughts? Probably not.

                I think Darwin would have arrived at his conclusion without Malthus but in some other way. Malthus inspired Darwin, this is true, but without him someone else probably would have inspired him instead.

                Though Darwin attended Christ’s College at Cambridge, he was not an extremely religious person. However, the church was not thrilled with Darwin’s discoveries of evolution because it strictly contradicted their belief of creation.

Very First Post!!!

I scoured the glossary for a cool title and came up with Terrestrial Taxonomy but thats not all we will cover in this course so I tacked on "and more".  
I really look forward to this class!
Kendell